Study on the definition and clinical significance of endothelial progenitor cells involved in hepatocellular carcinoma

Navigation:Home > Hepatobiliary Surgery > Hepatitis > Study on the definition and clinical significance of endothelial progenitor cells involved in hepatocellular carcinoma

Yu Decai, Ding YitaoI. IntroductionNear the ECs sprouting angiogenesis is an important condition on tumor development, metastasis and recurr

Content

Yu Decai, Ding Yitao

I. Introduction

Near the ECs sprouting angiogenesis is an important condition on tumor development, metastasis and recurrence, and is also an important factor affecting the prognosis of HCC [1]. Recent studies show that near the vascular endothelial sprouting is not the only way based on tumor angiogenesis (tumor, angiogenesis) of bone marrow derived endothelial progenitor cells (Bone marrow-derived endothelial progenitor cells, BM-EPCs) are also involved in tumor angiogenesis. The process is similar to that of the embryo, so it is usually named [2] (tumor vasculogenesis). EPCs is similar to embryonic stem cells, and has the characteristics of migration, proliferation and differentiation into ECs and function [3]. Current studies suggest that the cells expressing CD34, AC133/CD133, and VEGF receptor -2 (including the fetal liver kinase, Kinase Domain containing Receptor, KDR) of the inserted region are assumed to be EPCs[4], insert, [5].

Ali[6] and Shirakawa[7] were used to demonstrate the involvement of BM-EPCs in tumor angiogenesis, especially in early stage of tumor. In clinical studies, Hilbe and Dome proved that the EPCs directional homing to organize and participate in angiogenesis NSCLC [8], [9]. In different tumor models, EPCs was involved in tumor angiogenesis with weights ranging from 0.1% to 50% [10], [11]. In view of the EPCs homing characteristics, some scholars using the gene modified EPCs can significantly hinder tumor angiogenesis, reduce tumor growth, [12], [13], is expected to become a prognostic indicator of [14] tumor curative effect.

HCC high blood supply tumor. Most of the HCC secreting angiogenic factor a lot, such as vascular endothelial growth factor -165 (165-amino acid form of vascular endothelial growth factor, VEGF165, PDGF-BB), insulin-like growth factor (insulin-like growth, factor II, IGF-II) and bFGF [15] [16], [17], [18]. These factors play an important role in the process of angiogenesis, HCC occurrence, development and metastasis. At the same time, these factors can activate and mobilize BM-EPCs, raise EPCs homing ischemia and [19] in tumor tissue, promote the differentiation of EPCs into [20] ECs in ischemic angiogenesis and tumor [21].

Recently, University of Hong Kong professor Pan Dongping [22] confirmed: in the peripheral blood of HCC patients, circulating endothelial progenitor cells (circulating endothelial progenitor cells, CEPs) increased significantly, and the tumor invasion, alpha fetoprotein (alpha fetal, protein, AFP, VEGF) and interleukin -8 (interleukin-8, IL-8) level. However, until now, there is no direct evidence that EPCs is involved in angiogenesis of HCC. It is important to note that animal experiments and clinical trials have confirmed that bone marrow-derived stem cells (including EPCs) are involved in liver resection and [23] (CCl4) - induced acute and chronic liver injury in vascular remodeling, [24].

Therefore, we hypothesized that HCC secreted by the pro angiogenic factor mobilized BM-EPCs to participate in HCC angiogenesis. By detecting the levels of peripheral blood vessels and EPCs, the distribution of EPCs in liver tissue, and summarizing the clinical indexes, it was confirmed that EPCs was involved in angiogenesis of tumor and its clinical significance.

Two, materials and methods

1 patient and sample data

The study involved 64 patients with HCC from January 2004 to August 2006 in Nanjing Gulou Hospital Department of hepatobiliary surgery. Before surgery, patients received no other treatment. Collect the preoperative clinical data and laboratory findings, such as conventional liver function, blood routine, hepatitis B markers and AFP. Preoperative acquisition of EDTA (ethylenediaminetetraacetic acid, EDTA) anticoagulant for colony formation test (colony-forming unit, assays, CFUA), flow cytometry (Flow cytometry FCM), plasma and peripheral blood RNA extraction. 20 healthy adult male volunteers (mean age of 45 years, ranging from 38 to 59 years) served as normal controls. 4 liver transplantation donors and 4 liver tissues without liver disease were used as control group. The contents and methods of this study were discussed by the ethics committee of Gulou hospital.

Previous studies have shown that the EPCs involved in the promotion of angiogenesis factors such as VEGF[25] and HGF[26], high expression in the adjacent liver tissue. Therefore, we collected 3 different parts of the liver: 5 cm away from the foci (centimeters, CM) of the liver (tumor free tissue more than cm far from the tumor 5 edge, TF) as the control group 1; tumor within 2 cm tumor free liver tissue (adjacent non-malignant tissue within 2 centimeters. AT) as the control group 2; HCC (tissue from the tumor, TT). All samples were excluded from necrosis and hemorrhage, and kept in liquid nitrogen for 30 minutes after operation.

The pathological types of all samples were confirmed by Zhang Lihua, deputy director of the Department of Pathology, Drum Tower hospital. Classification of tumors based on Edmonson and Steiner[27]. The tumor invasion and invasion were observed by serial sections, and the degree of HCC invasion was confirmed by HCC scoring system ([28]).

2 colony forming assay and identification of endothelial progenitor cells: a detailed study of the appendix

Mononuclear cells (mononuclear, MNCs) from peripheral blood of HCC patients and healthy individuals were cultured at EGM-2 MV BulletKit (CC-3202, Cambrex Bio, Walkersville, MD, cells), and Science. After 48 hours, the non adherent cells were collected and cultured in another culture media of laminin (fibronectin, Sigma, St Louis), and then cultured for every 3 days. On the seventh day, the CFUs count.

Dil-AcLDL (Molecular Probes) and FITC were used to identify EPCs[29] (Sigma, St) in UEA-I (Louis). CFUs defines the number of cell clusters composed of a central circular cell and a peripheral spindle in reference to Hill[30], 40 times.

3 flow cytometry

FCM was used to detect the surface markers of CEPs in peripheral blood. 100µ L EDTA 5µ L anticoagulant, phycoerythrin (phycoerythrin, PE) chelate anti AC133 antibody (PE-CD133 Miltenyi, Biotec, Germany) and peridinin (Peridinin chlorophyll, protein, PerCP) chelate anti CD45 antibodies (PerCP-CD45, B&D, Heidelberg, Germany) and fluorescein isothiocyanate (fluorescein isothiocyanate, FITC) chelate anti CD34 antibodies (FITC-CD34, B&D, Heidelberg, Germany), 4 ˚ C were incubated for 30 minutes; IgG1-FITC and IgG2 alpha -PE antibody as the same type of control (B&D). After 5 minutes of red blood cell lysis, PBS was washed for about 1 times. FACS (Calibur) count 50000 cells, using WinMDI software (BD) to analyze the percentage of various surface marker cells. CD45-, CD34+ and CD133+ cells were used as EPCs.

4 immunofluorescence and confocal laser scanning

-30˚ C embedded frozen tissue sections of OCT, 4µ m thickness slice was used as fluorescence microscopy, and 20µ m thickness slice was detected by confocal laser scanning. Air dried at room temperature (about 10 minutes), put in acetone for about 4 minutes for minutes, then wash with PBS for about 5 minutes. 3% hydrogen peroxide was incubated with hydrogen peroxide for 5 to 10 minutes. PBS wash, repeat 3 times. 50µ (L, Miltenyi, Germany, 1:100) and FITC-CD34 (B&D, Heidelberg, Germany, 1:100), 37˚ (PE-AC133, Biotec, PBS, C) were incubated for 2 h and incubated as negative control. PBS was washed 3 times and placed under immunofluorescence (Zeiss Axiovert scope, Carl Zeiss Inc) or laser confocal (Confocal Laser Scanning Microscopy, MRC 1024, Bio-Rad Inc) detection.

5 immunohistochemistry (immunohistochemistry, IHC)

Frozen section: -30˚ C down OCT embedded frozen tissue slices, 4µ m thickness slices through room temperature air (about 10 minutes), put into the acetone for 4 minutes to fix the temperature for 10 minutes, PBS wash, repeat for 3 minutes. Anti AC133 antibody (monoclonal mouse anti-human antibody, Miltenyi Biotec, Germany, 1:100) or anti CD34 antibody (monoclonal mouse anti-human antibody, Santa Cruz, 1:300 4˚); C incubated overnight, PBS as negative control incubation. Then, the second generation of biotin labeled (DAKO, Carpentaria, CA), which was diluted with appropriate proportion, was incubated for 30 minutes at room temperature or room temperature for DAB minutes.

Paraffin section: the classic method of dewaxing, closed and antibody incubation, color. Anti PCNA antibody was purchased from DAKO Corp., CA). PCNA was divided into three grades according to the positive rate and positive degree: negative (below 10%), weak positive (from 10% to 50%) and medium strong positive (higher than 50%).

CD34 AC133 and MVD Gasparini 'reference counting: counting method in s standard [31] (Olympus microscope, CX-31 Olympus microscope) 200 times, Olympus camera (Olympus camera C-5050Z) camera, two independent researchers were counted. In the first 40 times light microscope scans the entire section, looking for a high vascular density, or "hot spots", and then in 200 times from the perspective of the number of vessels counting dyed brown, with 5 to 200 times (0.74 mm2) from the perspective of the average number of vascular hot spots as MVD.

6 Real-time PCR (real-time Polymerase Chain Reaction)

RNA extraction and reverse transcriptase using classical phenol chloroform method (Acid guanidine thiocyanate-phenol-chloroform extraction) RNA was extracted from liver tissue; peripheral blood RNA was extracted by Trizol method (Life Technologies Maryland). ExScriptTM reverse transcription Kit (TaKaRa, JP) was used to reverse the largest number of RNA. Detailed steps refer to appendix.

PCR: AC133, CD34 3- and glyceraldehyde-3-phosphate dehydrogenase (glyceraldehyde-3-phosphate dehydrogenase, GAPDH) gene primers by the Shanghai based biotechnology company with Primer Kang Express 2 software (Applied Biosystems, Foster City, CA) were designed and synthesized. The basic information of the primers is summarized in table 1-1.

The probe method (TaqManTM, Molecular Beacon) in RT-PCR:20- L including 2-µ Stratagene Mx3005P according to the following reaction system and reaction conditions; L cDNA template, 900 nM primers, 250 nM, 5 Mg2+, 0.1 mM probe U/µ L Ex Taq HS (ExScriptTM real-time PCR Kit, TaKaRa); reaction conditions 95 ~ C 20 seconds 1 cycles, 95 degrees C and 60 degrees C for 5 seconds and 20 seconds, a total of 55 cycles. Each sample was repeated 3 times. Using LinRegPCR software (version 7, c.r.ramakers@amc.uva.nl) the amplification efficiency of each gene is calculated by reference to Pfaffl[32], based on the amplification efficiency and Ct value of each gene in each sample relative to the reference of the relative expression level (GAPDH).

Table 1-1 and primer information table

Gene name

NCBI reference sequence

Upstream primer

Downstream primer

Probe sequence and exon location

Product size

AC133

NM_006017

GACCGACTGAGACCCAACATC

AGGTGCTGTTCATGTTCTCCAA

FAM- CAACAGCGATCAAGG-MGB

7 and 8

One hundred and three

CD34

NM_001025109

CCTTGCAACATCTCCCACTAAAC

TTCACTTCTCTGATGCCTGAACA

FAM-ACATCAAGGCAGAAAT-MGB

3 and 4

Ninety-six

KDR

NM_002253

GCTCAAGACAGGAAGACCAAGAA

TTCCCCAATACTTGTCGTCTGAT

FAM- TCACAGTCCTAGAGCGTGT-MGB

13 and 14

One hundred and seventeen

GAPDH

NM_002046

GGGCTGCTTTTAACTCTGGTAAAG

CCATGGGTGGAATCATATTGG

FAM-CCTCAACTACATGGTTTAC-MGB

1 and 2

One hundred and three

7 Determination of plasma VEGF165 and PDGF-BB protein levels in plasma and tumor tissues

Plasma and tumor tissue plasma VEGF165 and PDGF-BB protein concentrations were determined by reference to Poon 15. Peripheral venous blood was collected before operation and centrifuged (3000 rpm, 10 min) to obtain plasma in -80˚ C preservation. The total protein was obtained by the method of tissue homogenate and protein lysis. Detailed operation steps refer to appendix. VEGF165 and PDGF-BB concentrations in plasma and tumor tissues were determined by ELISA Kit (VEGF165 and PDGF-BB Immunoassay; Lifekey). At the same time by Coomassie brilliant blue (Coomassie plus protein assay reagent, Pierce Chemical Co, Rockford, IL) for determination of total protein concentration in tumor cells. The relative concentration of VEGF165 and PDGF-BB in tumor tissues was calculated based on the total protein concentration.

8 clinical follow-up

Collect clinical data and input database. Follow up plan: the level of AFP in peripheral blood of every March test, chest X-ray, ultrasound and abdominal CT hepatobiliary if necessary. The mean follow-up period was 14 months (range, 3 to 34 months). The diagnosis of tumor recurrence with AFP and abdominal CT, if necessary, liver puncture. Clinical follow-up was terminated in October 1, 2006.

statistical analysis

All data are expressed as mean + standard deviation. SPSS, Inc, Chicago, ANOVA (Version 11.5, Illinois, USA) were used to analyze t-test, linear regression and linear regression according to different situations. The P value is less than or equal to 0.05 that has a significant difference.

Three, results

1 patient data

A total of 64 HCC patients (53 males and 11 females) underwent surgical resection in the Department of hepatobiliary surgery of Nanjing Gulou Hospital. Among them, a total of 57 patients underwent liver resection and a total of 7 patients underwent orthotopic liver transplantation. The average tumor size was 6.65 + cm, ranging from 0.8 to 20 cm, respectively. 52 cases of liver function was Child 's A, and liver function was Child' s B in all the 11 cases, and the liver function of the 1 cases was Child 's C. 60 patients with liver cirrhosis, and 4 with chronic hepatitis. Cause liver disease hepatitis: 56, hepatitis B, hepatitis C 1, 1 mixed hepatitis, 4 patients with alcoholic liver disease of unknown etiology, 3. According to the 2002 UICC standard [33], 25 cases were HCC I phase, the II phase was HCC in 12 cases, the III phase was in HCC phase in the other group, and the IV phase was HCC in 1 cases.

2 HCC peripheral blood endothelial progenitor cell mobilization

The content of CEPs in peripheral blood is low, so it is difficult to separate. So far, there is no exact definition of the standard EPCs. Based on the previous studies, the current commonly used DiI-acLDL uptake and UEA-1 binding test setting, using FCM (protein level) or real-time PCR (mRNA) and the CFUA phenotype is quantitative, qualitative and quantitative [34] on EPCs, [35].

In this study, the classical MNCs induction method was used to induce peripheral blood EPCs. With the prolongation of induction, the morphological changes of peripheral blood EPCs: cultured for 7 days, EPCs cloning, single cell with ellipse (Fig. 1-1A and Fig. 1-2); 14 days of incubation, CFUs still exists, but the peripheral spindle cell is dominant (Figure 1-1B); CFUs reduced, cultured for 21 days. The periphery of fusiform cells were increased (Figure 1-1C); 28 days of culture, the formation of the typical cobblestone like cells, part of the tube formation (Figure 1-1D). We also used DiI-acLDL uptake and FITC-UEA-1 binding assay confirmed CFUs type Shuangyang cell clusters (Figure 1-3A-C).

We use the classical method to induce HCC patients with peripheral blood type EPCs, and counting the number of typical CFUs (central and peripheral circular cells composed of fusiform cell clusters, 1-3D and E). The average number of CFUs in peripheral blood of patients with HCC was 35.20 + / - 7.56 (n=5), which was significantly higher than that of the control group, with a mean of 15 + / - 4.06 (n=5) (p=0.001) (Figure 1-3F).

Figure 1-1, morphological changes of EPCs induced by peripheral blood. A-D cells were cultured for 7, 14, 21 and 28 days (magnification, * 100).

Figure 1-2, different times under the microscope typical CFUs diagram. The typical CFUs is a central circular cell with a peripheral spindle like cell mass, as shown in Figure 40 (A, x, B, x, 100; C, X and D, * 400).

Figure 1-3 and EPCs identification and quantitative comparison in vitro.

MNCs cells were cultured for 7 days, and the typical CFUs binding UEA-1 (A, green fluorescence) and Dil-acLDL (B, red fluorescence) were observed under fluorescence microscope. Double positive cells were identified as EPCs (C). D and E showed typical health and HCC peripheral blood CFUs (magnification, * 40). CFUs comparison of 1 * MNCs in peripheral blood from healthy and HCC patients with F. (**=p = 0.01)

Fig. AC133 and CD34 positive cells in peripheral blood of patients with 1-4, HCC and healthy controls. A, CD45 negative MNCs gating; B, isotype control chart; C, healthy control group peripheral blood AC133 and the percentage of CD34 positive cells; D, HCC in peripheral blood of patients with AC133 and the percentage of CD34 positive cells; E, HCC patients (n = 11) and healthy controls (n = 6) comparison of peripheral blood AC133 and the percentage of CD34 positive cells; F, HCC patients (n = 12) and healthy controls (n = 5) of peripheral blood AC133 mRNA relative expression level. + SD; *=p = 0.05; **=p = 0.01.

Figure 1-5, AC133+ and CD34+ positive cells in HCC tissue distribution. FITC-D34 antibody (green) and PE-AC133 antibody (red) with frozen sections. A-C, AC133 and CD34 double positive cells were located in the intima, AC133 positive cells were CD34 positive, and located in the portal vein (A and B) and microvessels (B and C). Arrow refers to double positive cells (yellow). Confocal laser scanning examination further identified AC133 and CD34 double positive cells located in the portal vein (D-F) and microvessel (G-I). D and G, FITC labeled CD34 antibodies specifically bind to tumor vasculature; E and H, PE labeled AC133 antibody binding to the same cells; F and I, integration map (* 200).

The present study suggests that the cells expressing CD34, AC133/CD133 and KDR of the membrane proteins are assumed to be EPCs4,5. In this study, EPCs and Real-time PCR were used to detect the surface markers of FCM, and the content of EPCs was evaluated indirectly. The results showed that the average number of CD34 and AC133 double positive cells in peripheral blood of HCC was 0.82% + / - 0.12% (n=11), which was significantly higher than that of normal group (1-4A-E = 0.10%, n=6) (p=0.002). In addition, the results of real-time PCR showed that the relative expression level of AC133 gene in peripheral blood of HCC group (0.00061 +. 0.00021, n=12) was significantly higher than that in healthy group (p=0.039 = 0.00008, n=5) (Figure 1-4F).

Therefore, all the results showed that: HCC patients with peripheral blood mobilization of EPCs.

Figure 1-6, AC133 and CD34 antigens in the tissues of HC, TT, AT and TF. Serial sections of HC (A and E), TF (D and B) and AT (G and H) and TT (J and K) were performed with CD34 (A, D, G, and J) and AC133 immunization (B, E, H, and K) with typical pictures of histochemistry. The arrow that double positive cells. C, F, I, and L AC133 positive cells were integrated into HC, TF, AT, and TT tissue typical images of microvessels. (magnification, * 200).

3 AC133 and CD34 double positive cells were integrated into the tumor tissue

Immunofluorescence staining was used to determine the AC133 and CD34 double positive cell line EPCs. From the 10 different tumor patients with frozen sections showed that AC133 and CD34 double positive cells were localized in the vascular intima, AC133 positive cells were CD34 positive, and in the portal vein (Figure 1-5A and B) and micro vessel (Figure 1-5B and C) endometriosis. Confocal laser scanning examination further identified AC133 and CD34 double positive cells located in the portal vein and microvessels (Figure 1-5D-I).

4 EPCs was enriched in the liver tissues of HCC, especially the adjacent liver tissues

The results of serial sections of healthy liver tissue showed that both AC133 and CD34 positive cells were mostly located in the portal vein (Figure 1-6A-C) (IHC). In liver tissues of patients with tumors, AC133 and CD34 double positive cells were mostly located in vessels of different diameters, but were mainly located in microvessels (TF, 1-6D-E, AT, 1-6G-H, TT, 1-6J-K). AC133 positive microvessel and there are two main types: the branch of the small; no obvious lumen (endothelial sprouting) (Figure 1-6F, I and L). In addition, some AC133 positive cells were also found in interstitial tissue (Figure 1-6H).

AC133 microvessel count (AC133-MVD) showed that the AC133-MVD (n=4) in TT, AT and TF tissues were 53.56 +, 84.76 +, + 11.32 and + 48.33 + AC133-MVD (n=18 + +) in the tissues of, and, respectively. The CD34-MVD was 323.29 + / - 101.14, + 37.81 and + 86.51 + + 25.10, respectively. Paired t test showed that AC133-MVD was the highest in AT liver tissues, while CD34-MVD was highest in TT liver tissues (Figure 1-7A and B). In addition, AC133-MVD was significantly positively correlated with TT, AT, and TF (Figure 1-7C).

At mRNA level, relative to normal liver tissue (n=8), the relative levels of CD34 and AC133 in HCC liver tissue TT, AT and TF (n=64) significantly increased (Figure 1-8A and B) (mRNA). Paired t test showed that the expression of AC133 mRNA was highest in AT liver tissue (Figure 1-8A), while the expression of CD34 mRNA was highest in TT liver tissue (Figure 1-8B). In addition, in the HCC AT in liver tissues of CD34 and CD133 and TF mRNA relative expression level was significantly correlated (Figure 1-8C); and HCC in liver tissue TT, AT and TF in the three groups of AC133 mRNA levels significantly positive correlation (Figure 1-8D).

Therefore, it was confirmed that EPCs was enriched in the liver tissues of HCC, especially the adjacent liver tissues in mRNA and protein levels.

Figure 1-7, HC, TT, AT and TF organizations in AC133 and CD34-MVD

In A, HC (n=4), TF, AT and TT (n=18) AC133-MVD group (**=P = 0.01 and ##=P = 0.01, HC; and TF and TT). In B, HC (n=4), TF, AT and TT (n=18) CD34-MVD group (**=P = 0.01 and ##=P = 0.01, HC; and TF; $$=P = 0.01 and AT); C, TT, AT and TF three groups AC133-MVD correlation (Smoother and Regression Parameters)

Figure 1-8, HC, TF, AT and TT tissue relative expression levels of CD34 and AC133 genes

A, HC (n=8), TF, AT and TT (n=64) AC133 gene relative expression level comparison (*=P < 0.05, compared with HC; #=P = 0.05, compared with TT); B HC (n=8), TF, AT and TT (n=64) CD34 gene relative expression level comparison (*=P less than 0.05, compared with HC; #=P = 0.05; C) compared with TF in HC, TF, AT, and TT in AC133 and CD34 gene relative expression levels of D, TT, correlation analysis; correlation analysis of relative expression of AT and TF in the three groups of AC133 gene (Smoother and Regression Parameters)

5 elevated concentrations of VEGF165 and PDGF-BB associated with mobilization and recruitment of EPCs in plasma and liver tissue

VEGF165 and PDGF-BB activation and mobilization of BM-EPCs, raise EPCs homing ischemia and tumor tissue in 19, and promote the differentiation of EPCs into ECs in ischemia and tumor angiogenesis 20,21. HCC (n=15) in patients with preoperative plasma VEGF165 (223.80 + 32.19 pg/ml) and PDGF-BB (605.25 + 128.38 pg/ml) were significantly higher than the healthy control group (n=20) and plasma VEGF165 (24.79 + 4.88 pg/ml, p=0.003) and PDGF-BB (37.13 + 10.46 pg/ml, p=0.000) concentration (Figure 1-9A). The relative level of AC133 mRNA in peripheral blood was positively correlated with plasma VEGF concentration (r=0.629, p=0.009) and PDGF-BB (r=0.618, p=0.024) (Figure 1-9B). Therefore, plasma levels of VEGF165 and PDGF-BB may play an important role in mobilization and recruitment of EPCs in patients with HCC.

Figure 1-9, plasma and liver tissue VEGF165 and PDGF-BB concentrations

A, with HCC (HCC, n=20) and control group (HC, n=15) comparison of plasma VEGF165 and PDGF-BB concentration (**=P = 0.01); B, the relative expression level correlated with plasma VEGF165 and PDGF-BB concentration in peripheral blood of AC133 patients with HCC gene; C, HC (n=4), TF, AT and TT (n=14) VEGF165 and PDGF-BB were compared between (*=P = 0.05, **=P = 0.01, compared with HC; #=P = 0.05, ##=P = 0.01, and TT).

In the four groups, the relative concentration of VEGF165 (p=0.017) and PDGF-BB (p=0.001) was the lowest in the healthy control group. The relative concentration of VEGF165 in TT tissue was lower than TF (p=0.025) and AT (p=0.024), while the relative concentration of PDGF-BB was higher than TF (p=0.004) and AT (p=0.006) (n=14, as shown in figure 1-9C). And the relative levels of AC133 mRNA and AC133-MVD had no correlation with VEGF and PDGF-BB concentrations in liver tissue. Therefore, in addition to VEGF and PDGF-BB, EPCs recruitment and homing may also be affected by other factors.

6 the correlation between the relative level of AC133 mRNA in liver tissue and clinical indicators (summary: 1-2)

There was no significant difference in the relative levels of AC133 mRNA in liver tissue between the groups according to the sex, age, total bilirubin and glucose. AT AC133 mRNA in liver tissue and the relative level of platelet (>150 = or * 109/L), hepatitis B surface antigen (hepatitis B surface antigen, HBsAg), tumor capsule, lack of venous invasion, the positive rate of PCNA and early recurrence (or >6 months) significantly related; and in the TT mRNA and the relative level of AC133 in liver tissue the tumor capsule invasion was significantly correlated. Therefore, the relative level of AC133 mRNA in the liver of AT may be a biomarker of HCC progression.

Four, discussion

Previous studies suggested that cells expressing CD34, AC133 and KDR were identified as EPCs4,5. This research adopts CD34 and AC133 double positive standard, on the basis of the following: AC133 surface markers of progenitor cells have been used for assessment of circulating breast cancer [36], HCC22, [37] multiple myeloma and NSCLC9 tumors and tumor tissue levels of EPCs; the CD34-MVD has been identified as a classic evaluation of tumor angiogenesis, is a good indicator of diagnosis and prognosis of HCC; the KDR is not only expressed in liver cells and HCC cells, and the expression of ECs with cirrhosis and progenitor cells in HCC. In addition, we used IHC and Real-time PCR to confirm that the expression of KDR in three tissues of TT, AT and TF was diffusely distributed, and there was no significant difference between the three groups (Figure 1-10, 11). Therefore, KDR is not ECs, tumor cells or stem specific markers of [38] cells; the study showed that AC133 positive tumor stem cells (cancer stem cells, CSCs) although only the tumor tissue of 0.1-2.5%, but with the characteristics of cell proliferation, self-renewal and differentiation in stem, HCC[39], [40] prostate cancer and colon cancer [41] were identified as CSCs specific marker. However, until now, no studies have found that AC133 and CD34 double positive cells were CSCs. In this study, IHC and confocal laser AC133 and CD34 double positive cells in the vascular wall, which is in the form of dermoid tumor cells is not. In addition, further experiments confirmed that AC133 positive cells did not express hepatocyte or HCC specific antigen hepatocyte-1 antigen (Figure 1-12).

So far, the clinical significance of CEPs has been confirmed in breast cancer 36, NSCLC, 9 and HCC22. Especially in breast cancer, CEPs assay has been used as a specific marker for the optimization of the anti angiogenic dose 36. In this study, the relative expression in peripheral blood of AC133 patients with HCC gene and protein level is higher than the healthy control group, and positively correlated with plasma VEGF165 and PDGF-BB concentration and some clinical parameters (a small number of samples, not included in the official results, table 1-3). Poon et al. Confirmed that the CFUs score of peripheral blood in patients with non surgical resection of HCC was significantly higher than that of early surgical resection, liver cirrhosis and healthy controls, and was positively correlated with plasma VEGF and IL-8 concentrations of 22. Table 1-2, the correlation between AC133 level and clinical index of liver tissue mRNA

Clinical index

Grouping

Patient number

TF

AT

TT

average value

The value of P

average value

The value of P

average value

The value of P

Platelet

(109/L)

Recommand Articles

 

www.Cure001.comwww.Cure999.com

Cerebral Vascular Disease,Acne,Heart Disease,Deaf,Headache,Std,Condyloma Acuminatum,Fibroid,Pneumonia,Brain Trauma,。 Rehabilitation Blog 

Rehabilitation Blog @ 2017